|
|
||||
|
|
||||
|
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Rapid Report |
Division of Molecular Histopathology, Department of Pathology, University of Cambridge, Addenbrooke's Hospital, Cambridge, UK (K.I., D.M.P., S.K., R.C., D.T.W.J., V.P.C.); Department of Oncology-Pathology, Karolinska Institute, Karolinska University Hospital, Stockholm, Sweden (L.M.B.)
Address correspondence to Koichi Ichimura, Molecular Histopathology, Level 3, Lab Block, Addenbrooke's Hospital, Box 231, Cambridge CB2 0QQ, UK (ki212{at}cam.ac.uk).
| Abstract |
|---|
|
|
|---|
Key Words: astrocytoma oligodendroglioma 1p/19q loss oxidative stress p53
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
|
Genetic Analysis
The genomewide copy number data were determined by comparative genomic hybridization on a 1-Mb array, as previously described.8,9 The details of the 1-Mb array data will be published elsewhere (K.I., unpublished data). Primers for IDH1 exon 4 were according to Parsons et al.1 Sequencing was performed as previously described.10 Mutation analysis of all other genes—TP53, retinoblastoma 1 (RB1), phosphatase and tensin homolog (PTEN), and cyclin-dependent kinase inhibitor 2A (CDKN2A)—was performed as previously described.7,11
IDH1 Enzymatic Assay
A wild-type IDH1 expression vector construct with a 5' hemagglutinin (HA) tag was generated by amplifying cDNA synthesized from U251 cells (IDH1 wild type; see below) using primers PC5779 (TAGAATTCCACCATGGCTTACCCATACGATGTTCCAGATTACGCTATGTCCAAAAAAATCAGTGGC) and PC5778 (GTATGAATTCAAAGTTTGGCCTGAGCTAG) and subcloning the PCR product into pTracer-CMV2 (Invitrogen, Paisley, UK). All four IDH1 mutants identified in this study (see below) were generated by site-directed mutagenesis using a QuikChange XL site-directed mutagenesis kit followed by confirmatory sequencing (Agilent Technologies, Santa Clara, CA, USA). COS-7 kidney cells were transfected with the constructs using Lipofectamine 2000 (Invitrogen), harvested 48 h post-transfection, and lysed with the CelLytic M reagent (Sigma-Aldrich, Gillingham, UK). The supernatant was used for both the enzymatic assay and Western blotting. The IDH1 enzymatic assay was performed according to the manufacturer's recommendation (Sigma-Aldrich). Briefly, the substrate mix (42 mM glycylglycine buffer, 0.44 mM D,L-isocitric acid, 1 mM β-nicotinamide adenine dinucleotide phosphate [NADP], 0.6 mM MnSO4) was preincubated at 37°C for 10 min. The cell lysate equivalent to 5 µg total protein was then added to the premix, and the amount of NADPH produced was monitored by spectrophotometry at 340 nm at intervals for 25 min. The enzymatic activity was determined as
A340nm/min. Western blotting was performed as previously described10 using a rabbit anti-HA polyclonal antibody (Abcam, Cambridge, UK), a goat anti-IDH1 monoclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and a mouse anti–
-tubulin monoclonal antibody (Sigma-Aldrich).
Statistical Analysis
Statistical analyses were performed using Statistical Package for Social Sciences (SPSS) version 16.0 (SPSS, Inc., Chicago, IL, USA). Significance of correlations between the parameters was assessed using either the chi-square test with Yates's correction or two-tailed Fisher's exact test. The log-rank test was used for univariate analysis, and Cox regression was used for multivariate analysis of potential association between IDH1 mutations and overall patient survival.
| Results |
|---|
|
|
|---|
The prevalence of mutations in each tumor type is shown in Table 1. No PA had an IDH1 mutation. A and AA showed high frequencies of mutations (59% and 52%), while GBs had a very low mutation rate overall (6%). However, when divided into primary and secondary GBs, IDH1 mutations were found in only 6 of 173 (3%) of pGB, whereas they were present in 5 of 10 (50%) of sGBs (p <0.001). Xenografts established from one pGB (GB181) retained the same mutation (c.395G>A). A majority of the four subtypes of oligodendroglial tumors (O, AO, OA, and AOA) also had IDH1 mutations: 23 of 34 O (68%), 12 of 20 AO (60%), 10 of 20 OA (50%), and 18 of 23 AOA (78%). No mutations were found among the 50 ependymal tumors, 36 medulloblastomas, 8 supratentorial PNETs, 4 DNETs, 48 vestibular schwannomas, or 48 meningiomas. None of the 15 established glioma cell lines had IDH1 mutations. The details of the IDH1 mutations in individual tumors are presented in Supplementary Table 1S.
A majority of A, AA, and sGB tumors but only about 30% of pGBs are known to have TP53 mutations, while a majority of O, AO, OA, and AOA are known to have total 1p/19q loss and very unusual TP53 mutations.7,12 When all these tumors were included in one group (A, AA, GB, O, AO, OA, and AOA; total, 364 tumors), TP53 mutations were present in 142 and combined total 1p/19q loss was present in 54 tumors (Table 1). The TP53 mutations and total 1p/19q loss were, with the exception of three AOs, mutually exclusive (Supplementary Table 1S). When we looked for correlations between these two completely different genomic abnormalities and IDH1 mutations, we found that the vast majority of IDH1 mutations (109/119, 92%) were associated with TP53 mutation, total 1p/19q loss, or both (p <0.001; including two of the three AOs that had both TP53 mutations and total 1p/19q loss). Only 10 tumors with IDH1 mutations had neither TP53 mutations nor total 1p/19q loss. However, 77 (54%) of the tumors with TP53 mutations had no abnormality of IDH1 (1 A, 14 AA, 1 sGB, 56 pGB, 1 O, 1 AO, 1 OA, and 2 AOA), and seven cases had total 1p/19q loss with no IDH1 mutation (1 A, 1 AA, 1 GB, and 4 O). One AO had both TP53 mutation and total 1p/19q loss but no IDH1 mutation. Note that there were also astrocytomas with no TP53 or IDH1 mutation and oligodendrogliomas with neither total loss of 1p/19q nor IDH1 mutation, some of which had other detectable clonal genetic abnormalities.
When any abnormality of the p53 pathway was considered (TP53 mutation, MDM2/MDM4 amplification, or p14ARF homozygous deletion),7 it was significantly associated with IDH1 mutation only in astrocytomas (A and AA, p = 0.005). Abnormalities of the RB1 pathway (RB1 mutation, CDKN2A homozygous deletion or Cyclins/CDK4/6 [cyclin-dependent kinase 4/6] amplification) were negatively associated with IDH1 mutation in adult astrocytic tumors (all A, AA, and GB; p <0.001) but not in oligodendroglial tumor groups. Among all the adult astrocytic tumors, IDH1 mutations were also negatively associated with PTEN mutations (p <0.001; no tumor had both IDH1 and PTEN mutations) and with EGFR amplifications (p <0.001; only one tumor had both an IDH1 mutation and EGFR amplification).
The enzymatic activity of IDH1 resulting in the production of NADPH was assayed using COS-7 cells transfected with the wild-type and all four mutant IDH1 constructs. The Arg132His, Arg132Ser, and Arg132Cys mutants showed an 8- to 9-fold decrease of enzymatic activity. Arg132Gly showed a 2.4-fold decrease compared with wild type (p <0.001, t-test; Fig. 1), thus showing a significantly higher level of activity than the other three mutants (p <0.001). All transfectants showed higher levels of activity than the negative control (vector-alone transfectants; p <0.05).
|
Univariate analyses using the log-rank test were used to assess the impact of IDH1 mutation on overall survival. IDH1 mutations were associated with longer overall survival among all 364 tumors (including all A, AA, GB, O, AO, OA, and AOA; p <0.001), all adult astrocytic tumors (including A, AA, and GB; p <0.001), and even among all GBs (p = 0.011; Supplementary Fig. 2S). However, Cox regression multivariate analysis including age, histological diagnosis, WHO malignancy grade, TP53, 1p/19q status, and primary/secondary GB indicated that IDH1 status was not an independent prognostic factor.
| Discussion |
|---|
|
|
|---|
The finding that the majority of IDH1 mutations are associated with either TP53 mutation or total 1p/19q loss is striking. TP53 mutations and total 1p/19q loss are generally mutually exclusive12 and characterize WHO grade II diffuse astrocytomas and oligodendrogliomas, respectively, both of which are well known to show malignant progression. There are no known cellular consequences common to these two aberrations. However, based on these findings, the genetic models for development and progression of astrocytic and oligodendroglial tumors must be revised and include mutation of IDH1 as an early event common to both types of glioma (Fig. 2, Supplementary Table 1S). In this model, the majority of oligodendrogliomas develop through acquisition of concurrent IDH1 mutation and total 1p/19q loss (as a result of t[1;19] translocation), and grade II tumors may progress, some acquiring RB1 pathway abnormalities. The majority of diffuse astrocytomas arise through developing concomitant mutations of IDH1 and TP53. These tumors generally acquire RB1 pathway alterations when they progress to sGBs. The alternative pathway for GB development, resulting in a pGB, is via synchronous RB1 and p53 pathway disruption,7 and this does not seem to be associated with IDH1 mutation. Disruptions of the p53 pathway by mechanisms other than TP53 mutation occur predominantly among pGB. Primary GBs may also have Akt pathway disruption (e.g., by PTEN mutation/deletion) and/or EGFR amplification (with or without rearrangement), unlike other astrocytomas or oligodendrogliomas. Oligoastrocytic tumors appear to develop through pathways similar to either the grade II/III astrocytomas or the oligodendrogliomas (i.e., IDH1 mutation and either TP53 mutation or total 1p/19q loss). Pilocytic astrocytomas do not progress, and the majority have either a unique fusion gene containing the constitutively activated kinase domain of v-raf murine sarcoma viral oncogene homolog B1 (BRAF) or mutations of BRAF or neurofibromin 1 (NF1).10 They have no IDH1 mutations or any other changes described above.
|
IDH1 functions as a homodimer, is localized in peroxisomes and more diffusely in the cytoplasm, and catalyzes oxidative decarboxylation of isocitrate into
-ketoglutarate, generating NADPH from NADP+.14 NADPH is an important cofactor for regeneration of reduced glutathione, which is a critical component of the defense mechanism against oxidative damage.15,16 High levels of oxidative stress are reported in the brain compared with other organs. This is reflected in the common transition mutations (G:C
A:T) seen in gliomas, for example, of TP53.17 This was also the case in 81 of 142 (57%) of the TP53 mutations and 114 of 119 (95%) of the IDH1 mutations in our series, with only 5 of 119 (4%) mutations of IDH1 being of any other type.
The 119 somatic mutations, almost all of which were heterozygous, resulted in the substitution of arginine with histidine, serine, or cysteine at codon 132. We showed that the ability to generate NADPH was significantly reduced in all four mutant IDH1 proteins. These results indicate that Arg132 is critical for the enzymatic activity of IDH1. Jennings et al.18 reported that a substitution of arginine by glutamate at codon 132 in a rat ortholog of IDH1 resulted in a significant reduction in catalytic activity. Although this mutation has not been seen in humans, their observations are in line with ours. Arg132 is one of the amino acids in IDH1 that form hydrophilic interactions with the
- and β-carboxylate groups of isocitrate.19 It has also been proposed that Arg132 may contribute to a semiopen conformation of IDH1 during the transition from the inactive form to the active form of the enzyme.19 Substitution of Arg132 may therefore result in conformational changes with a consequent decrease in enzymatic activity.
Because the protein functions as a dimer, the consequences of mutation of one allele may be profound, since one mutated protein in a homodimer may result in a significant reduction in function—producing a dominant negative effect in a similar manner to p53 (functioning as a tetramer). Thus, mutation of one allele of IDH1, which results in the decreased ability to generate NADPH as shown in this study, is likely to lead to an increased susceptibility to oxidative damage and thus facilitate the accumulation of further, especially transition, mutations (G:C
A:T). Cells with reduced IDH1 expression have increased levels of oxidative stress and DNA damage.16 The finding that IDH1 mutations frequently accompany TP53 mutations in the diffuse astrocytomas is particularly notable, because loss of p53 will circumvent normal oxidative-stress–induced apoptosis, as has been demonstrated in glioma cells.20 This combination will therefore likely promote further mutations and tumor progression. It is more difficult to understand the association of IDH1 mutation with the total concurrent loss of 1p/19q.
The fact that there were no mutations in the 15 established glioma cell lines is not surprising because almost all such lines are derived from GBs, and most of these were probably pGB. Most were derived many years before the differential classification of GBs into primary and secondary, and there are no data to indicate their status.
We confirmed that IDH1 mutations occur more frequently among sGB and young patients with GB, as reported by Parsons et al.1 Univariate analyses also showed that tumors with IDH1 mutations were associated with longer overall survival of patients with any adult astrocytic or oligodendroglial tumor included in the series, with any adult astrocytic tumor alone, or with any GB. However, multivariate analysis failed to identify IDH1 status as a prognostic factor independent of tumor type, grade, or age. These results are not surprising, because IDH1 mutations are involved in both oligodendroglial and astrocytic tumors and represent only one of a diverse range of genetic abnormalities, and are therefore unlikely to be an independent prognostic factor.
IDH1 mutations appear to be rare in other common human tumors. One IDH1 mutation (Arg132Cys) in a colon cancer has been reported in a genomewide mutation analysis of a series of colon and breast cancers,21 and no mutations were found in a series of pancreatic cancers.22 Bleeker et al.23 found no mutations in IDH1 exon 4 among 559 various nonglioma human cancers, including bladder, breast, colorectal, lung, melanoma, thyroid, ovary, and pancreas. High levels of oxidative stress in the brain compared with other organs may provide strong selective pressure for tumor cells that acquired IDH1 mutations.
Our results indicate that IDH1 mutation is common in A, AA, and sGB as well as all types of oligodendroglial tumors, but infrequent in pGB, thereby helping to distinguish pGBs from the others. Consequently, the models of astrocytic and oligodendroglial tumor development/progression require some revision. We also show that the missense mutations identified at Arg132 result in decreased enzymatic activity of IDH1. Further assessments of the cellular consequences of IDH1 mutations are under way. We hope a more accurate understanding of the genetic changes and their consequences in these tumors will lead to improvements in the accuracy of diagnosis and prognosis, and the development of novel molecular targeted therapies.
It is important to note that after this paper was submitted for publication we identified somatic missense mutations at codon 172 (arginine) of IDH2 in seven tumors that had either TP53 mutation or total 1p/19q loss but no IDH1 mutations. As a result, all oligodendroglial tumors with total 1p/19q loss harbored mutations of either IDH1 or IDH2, while six oligodendroglial tumors with IDH1 mutation had neither total 1p/19q loss nor TP53 mutations. This strongly suggests that mutations of the NADP+-dependent IDH genes are the earliest changes in the development of oligodendroglial tumors.
| Acknowledgments |
|---|
This work was supported by grants from Cancer Research UK, Samantha Dickson Brain Tumour Trust, Jacqueline Seroussi Memorial Foundation for Cancer Research, and Cambridge Fund for the Prevention of Disease (CAMPOD).
Received for publication November 21, 2008. Accepted for publication February 23, 2009.
| References |
|---|
|
|
|---|
Parsons DW, Jones S, Zhang X, et al. An integrated genomic analysis of human glioblastoma multiforme. Science. 2008;321: 1807-1812.
Louis DN, Ohgaki H, Wiestler OD, Cavenee WK. WHO Classification of Tumours of the Central Nervous System. 4th ed. Lyon, France: International Agency for Research on Cancer; 2007.
Collins VP. Mechanisms of disease: genetic predictors of response to treatment in brain tumors. Nat Clin Pract Oncol. 2007;4: 362-374.[CrossRef][Web of Science][Medline]
Ohgaki H, Kleihues P. Genetic pathways to primary and secondary glioblastoma. Am J Pathol. 2007;170: 1445-1453.
Husemann K, Wolter M, Buschges R, Bostrom J, Sabel M, Reifenberger G. Identification of two distinct deleted regions on the short arm of chromosome 1 and rare mutation of the CDKN2C gene from 1p32 in oligodendroglial tumors. J Neuropathol Exp Neurol. 1999;58: 1041-1050.[Web of Science][Medline]
Jenkins RB, Blair H, Ballman KV, et al. A t(1;19)(q10;p10) mediates the combined deletions of 1p and 19q and predicts a better prognosis of patients with oligodendroglioma. Cancer Res. 2006;66: 9852-9861.
Ichimura K, Bolin MB, Goike HM, Schmidt EE, Moshref A, Collins VP. Deregulation of the p14ARF/MDM2/p53 pathway is a prerequisite for human astrocytic gliomas with G1-S transition control gene abnormalities. Cancer Res. 2000;60: 417-424.
McCabe MG, Ichimura K, Liu L, et al. High-resolution array-based comparative genomic hybridization of medulloblastomas and supratentorial primitive neuroectodermal tumors. J Neuropathol Exp Neurol. 2006;65: 549-561.[Web of Science][Medline]
Jones DT, Ichimura K, Liu L, Pearson DM, Plant K, Collins VP. Genomic analysis of pilocytic astrocytomas at 0.97 Mb resolution shows an increasing tendency toward chromosomal copy number change with age. J Neuropathol Exp Neurol. 2006;65: 1049-1058.[CrossRef][Web of Science][Medline]
Jones DT, Kocialkowski S, Liu L, et al. Tandem duplication producing a novel oncogenic BRAF fusion gene defines the majority of pilocytic astrocytomas. Cancer Res. 2008;68: 8673-8677.
Schmidt EE, Ichimura K, Goike HM, Moshref A, Liu L, Collins VP. Mutational profile of the PTEN gene in primary human astrocytic tumors and cultivated xenografts. J Neuropathol Exp Neurol. 1999;58: 1170-1183.[Web of Science][Medline]
Ino Y, Betensky RA, Zlatescu MC, et al. Molecular subtypes of anaplastic oligodendroglioma: implications for patient management at diagnosis. Clin Cancer Res. 2001;7: 839-845.
Balss J, Meyer J, Mueller W, Korshunov A, Hartmann C, von Deimling A. Analysis of the IDH1 codon 132 mutation in brain tumors. Acta Neuropathol. 2008;116: 597-602.[CrossRef][Medline]
Geisbrecht BV, Gould SJ. The human PICD gene encodes a cytoplasmic and peroxisomal NADP(+)-dependent isocitrate dehydrogenase. J Biol Chem. 1999;274: 30527-30533.
Kim SY, Park JW. Cellular defense against singlet oxygen-induced oxidative damage by cytosolic NADP+-dependent isocitrate dehydrogenase. Free Radic Res. 2003;37: 309-316.[CrossRef][Web of Science][Medline]
Lee SM, Koh HJ, Park DC, Song BJ, Huh TL, Park JW. Cytosolic NADP(+)-dependent isocitrate dehydrogenase status modulates oxidative damage to cells. Free Radic Biol Med. 2002;32: 1185-1196.[CrossRef][Web of Science][Medline]
Ohgaki H, Kleihues P. Epidemiology and etiology of gliomas. Acta Neuropathol. 2005;109: 93-108.[CrossRef][Medline]
Jennings GT, Minard KI, McAlister-Henn L. Expression and mutagenesis of mammalian cytosolic NADP+-specific isocitrate dehydrogenase. Biochemistry. 1997;36: 13743-13747.[CrossRef][Web of Science][Medline]
Xu X, Zhao J, Xu Z, et al. Structures of human cytosolic NADP-dependent isocitrate dehydrogenase reveal a novel self-regulatory mechanism of activity. J Biol Chem. 2004;279: 33946-33957.
Datta K, Babbar P, Srivastava T, Sinha S, Chattopadhyay P. p53 dependent apoptosis in glioma cell lines in response to hydrogen peroxide induced oxidative stress. Int J Biochem Cell Biol. 2002;34: 148-157.[CrossRef][Web of Science][Medline]
Sjoblom T, Jones S, Wood LD, et al. The consensus coding sequences of human breast and colorectal cancers. Science. 2006;314: 268-274.
Jones S, Zhang X, Parsons DW, et al. Core signaling pathways in human pancreatic cancers revealed by global genomic analyses. Science. 2008;321: 1801-1806.
Bleeker FE, Lamba S, Leenstra S, et al. IDH1 mutations at residue p.R132 (IDH1(R132)) occur frequently in high-grade gliomas but not in other solid tumors. Hum Mutat. 2009;30: 7-11.[CrossRef][Web of Science][Medline]
Fuxe J, Akusjärvi G, Goike HM, et al. Adenovirus-mediated overexpression of p15INK4B inhibits human glioma cell growth, induces replicative senescence, and inhibits telomerase activity similarly to p16INK4A. Cell Growth Differ. 2000;11: 373-384.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|