|
|
||||
|
|
||||
|
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Basic and Translational Investigations |
Dardinger Laboratory for Neuro-oncology and Neurosciences, Department of Neurological Surgery, The Ohio State University Medical Center and James Comprehensive Cancer Center, Columbus, OH (M.O.N., J.L.C., J.G., N.D, E.A.C., S.E.L, Y.S., M.N., H.N.); Michigan Center for Theoretical Physics and Department of Physics, University of Michigan, Ann Arbor, MI (A.M.S., L.M.S.); Translational Genomics Institute, Phoenix, AZ (M.E.B.), USA
Address correspondence to E. Antonio Chiocca or Sean Lawler, Dept. of Neurological Surgery, The Ohio State University Medical Center Wiseman Hall, 400 West 12th Avenue, Columbus, OH 43210 (EA.Chiocca{at}osumc.edu or Sean.Lawler{at}osumc.edu).
| Abstract |
|---|
|
|
|---|
or GSK-3β isoforms both reduced cell motility. These data outline previously unidentified pathways and inhibitors that may be useful for the development of novel anti-invasive therapeutics for the treatment of brain tumors.
Key Words: glioma GSK-3 invasion lithium motility
| Introduction |
|---|
|
|
|---|
In this study, we examined the effects of lithium on glioma cell migration and invasion. Lithium has been used clinically in the treatment of bipolar disorder for more than 50 years and has profound effects on a variety of processes, including metabolism, neuronal communication, and cell proliferation and development.8,9 It has not been studied in the context of glioma invasion. In this report, we show that lithium potently and specifically blocks glioma cell migration in a range of assays and that additional inhibitors of the serine/threonine protein kinase glycogen synthase kinase-3 (GSK-3) have very similar effects. GSK-3 is known to be inhibited by lithium,10,11 suggesting that GSK-3 could possibly be mediating the effects of lithium on glioma cell migration. Our data suggest that lithium and other GSK-3 inhibitors may represent a novel class of potential anti-invasive therapeutics.
| Materials and Methods |
|---|
|
|
|---|
EGFR cell lines were provided by Drs. Huang and Cavenee (Ludwig Institute for Cancer Research, La Jolla, CA, USA). The human glioblastoma biopsies, X12 and X14 (from Dr. C. David James, Mayo Clinic, Rochester, MN, USA), were maintained as flank tumors in nude mice as described.12 The H2BGFP fusion expression vector was obtained from Geoffrey Wahl (Salk Institute, La Jolla, CA, USA) and stably transfected into U87 cells. All cells were grown in DMEM (Invitrogen, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. Human fetal astrocytes were purchased from Cambrex and cultured according to manufacturer's recommendations. Chemicals used were LiCl and myo-inositol (Sigma-Aldrich, St. Louis, MO, USA), AR-A014418 (Invitrogen, Carlsbad, CA, USA), SB415286 (Tocris Bioscience, Ellisville, MO, USA), and L-690,330 (Alexis Biochemicals, San Diego, CA, USA).
Cell Invasion/Migration Assays
For three-dimensional spheroid cultures, 1,000 cells were cultured as hanging drops as described.13 The cell aggregate was transferred into 300 µl neutralized collagen I solution in an 8-well chamber slide (Nalgene, Rochester, NY, USA). Collagen (PureCol, Inamed, Fremont, CA, USA) was neutralized to pH 7.5 using 1N NaOH and supplemented with 2% FBS, penicillin-streptomycin, and 0.5x DMEM. After polymerization at 37°C, the collagen was overlaid with 300 µl of standard medium with or without inhibitors. Spheroid expansion and all other microscopy-based assays were monitored using a Zeiss LSM510 confocal microscope system (Carl Zeiss Inc., Thornwood, NY, USA) and edited/quantified using ImageJ (http://rsb.info.nih.gov/ij/) and Excel (Microsoft, Redmont, WA, USA). For detailed analysis, high-resolution images were analyzed by the method of Stein et al.14 Wound-healing assays were performed by scratching confluent monolayers of U373 cells in 8-well chamber slides with a 20 µl pipette tip 1 h after addition of inhibitor-containing medium. For GSK-3 knockdown, 100 pmols of Smartpool GSK-3
or GSK-3β siRNA (GSK-3
, GGACAAAGGUGUUCAAAUCUU, GAACCCAGCUGCCUAACAAUU, GCGCACAGCUUCUUUGAUGUU, GCUCUAGCCUGCUGGAGUAUU; GSK-3β, GAAGAAAGAUGAGGUCUAUUU, GGACCCAAAUGUCAAACUAUU, GAUGAGGUCUAUCUUAAUCUU, GAAGUCAGCUAUACAGACAUU) or scrambled siRNA control (Dharmacon, Chicago, IL, USA) was introduced into cells with Lipofectamine 2000 (Invitrogen) in a 6-well plate 48 h prior to the wound-healing assay. The area of the gap between migrating edges of cells was used to quantitate the assay. Transwell assays were performed using 8 µm pore size inserts (ISC Bioexpress, Kaysville, UT, USA). Fifty thousand cells were allowed to migrate for 6 h prior to fixation in 1% glutaraldehyde and cell visualization by staining with 10 µg/ml DAPI (Sigma).
Brain slices were aseptically prepared from postnatal day 5–7 mice using a vibratome (Leica VT1000S). Three hundred µm slices were incubated at 36°C on 0.4 µm pore size inserts (Millicell-CM) with filtered MEM (Invitrogen) (50%), 25% FBS and 25% HBSS (Invitrogen), 1 mM L-glutamine, and 36 mM D-glucose. A glioma spheroid was carefully placed on the surface of the brain slice after 3 weeks in culture. To visualize spheroid cell migration, brain slices were fixed in 4% paraformaldehyde and stained with rabbit antihuman vimentin antibody SP20 (Neomarkers, Fremont, CA, USA).
TCF-Lef Luciferase Reporter Assay
The β-catenin reporter plasmid pSuper8XTOPflash or pSuper8XFOPflash (control) (from Dr. Randall Moon, University of Washington, Seattle, WA, USA)15 was transfected into U87 cells, seeded at 60,000 cells/well in a 12-well plate using Lipofectamine 2000. Promoter activity was determined by measuring luciferase levels in a Fluostar Optima plate reader (BMG Labtech, Durham, NC, USA). This was carried out in triplicate and FOP-flash used as a background control. The renilla luciferase expression vector pRL-tk (Promega, Madison, WI, USA) was cotransfected as a control.
Cell Viability, Cell Death, and Cell Cycle Analyses
Cell viability was measured using the WST-1 assay (Roche, Palo Alto, CA, USA) in 96 well plates, according to manufacturer's recommendations. Propidium iodide exclusion and flow cytometry–based cell cycle analysis was carried out by standard methods. Cell cycle analysis was carried out using fluorescence-activated cell sorting (FACS) with a FACSCalibur machine (Becton Dickinson, Franklin Lakes, NJ, USA).
Immunostaining and Western Blotting
Actin staining of U87 cell spheroids in collagen I was performed with Alexa Fluor 568-phalloidin (Invitrogen) according to manufacturer's recommendations. For Western blotting, proteins (30 µg) were separated by SDS-PAGE and transferred to nitrocellulose. Antibodies used for Western blotting were mouse anti-GSK-3
β (BD Biosciences, Rockville, MD, USA) and peroxidase conjugated secondary antibodies (Jackson Laboratories, Bar Harbor, ME, USA).
| Results |
|---|
|
|
|---|
In the course of examining these spheroids, we serendipitously discovered that lithium, an FDA-approved drug used in the treatment of bipolar disorder, caused a near complete blockade of cell invasion in X12 glioma spheroids over a 96 h time period (Fig. 1A). In order to confirm that these effects were reproducible in another assay and with other glioma cells, we employed the wound-healing assay for cell migration. A pronounced effect on migration of U373 glioma cells across the wound gap was observed in the presence of 20 mM LiCl compared to 20 mM NaCl control (Fig. 1B).
|
|
To provide more quantitative data, confocal microscopic images of U87 cells stably expressing nuclear GFP were analyzed by counting the number of invasive cells outside the tumor core.14 The core and rim of the spheroid can be distinguished in microsopic images as shown in Fig. 3A. The number of cells that occupied the three-dimensional volume of the matrix outside the spheroid core (the "invasive" zone) were enumerated as a function of time after treatment with several different concentrations of lithium. This showed a concentration-dependent reduction in the number of migrating cells. This result was significant even at lithium concentrations as low as 2.5 mM (Fig. 3B). In addition to measuring the absolute number of single cells found away from the tumor core, we also measured the cell density of invasion as a function of time (Fig. 3C). This showed that in addition to a decrease in cell number, lithium reduced the overall distance of migration when compared to control. Lithium therefore affects both the total distance migrated and the total numbers of cells that migrate, and these effects are detectable in vitro at lithium concentrations approaching those known to be therapeutically achievable in humans (<2 mM).7
|
In summary, the above results show that lithium potently and reversibly inhibits invasion of glioma cells in the spheroid model, in a time- and dose-dependent fashion.
Lithium Also Affects Cell Cycle Kinetics in Glioma Cells
We then examined the effects of lithium treatment on glioma cell viability. Compared with migration assays, the effects of lithium treatment on cell viability were quite small: a reduction in viability of about 20% was seen after 48 h of 20 mM lithium treatment in U87 cells (Fig. 4A), and at 5 mM and 10 mM lithium no significant changes in cell viability were seen, in contrast to the highly significant inhibition of migration at a similar time point (p < 0.0001 for 10 mM lithium; p = 0.03 for 5 mM lithium [Fig. 2B]).
|
Lithium Treatment Inhibits Formation of Extensions at the Leading Edge of Migrating Glioma Cells
Microscopic examination revealed that the inhibition of cell migration in glioma spheroids by lithium was associated with retraction of the long protrusions at the front of the invading cells (Fig. 5A). Upon lithium removal, these morphological changes were reversible with regrowth of the extensions and resumption of migration (data not shown). X12 glioma spheroids were also cultured on mouse organotypic brain slices. Immersion of the brain slice in 20 mM LiCl for 24 h slowed glioma cell migration and caused cells to become less elongated and to round up (Fig. 5B). This effect was also observed using U87 cells (data not shown), and shows that lithium inhibits invasion in the context of a physiologically relevant matrix.
|
|
GSK-3 inhibition is known to promote the stability and transcriptional activity of β-catenin.15 In order to determine the level of GSK-3 inhibition in drug-treated glioma cells, we assayed the activity of a β-catenin responsive luciferase reporter plasmid in GSK-3 inhibitor treated U87 cells. A dose-dependent increase of reporter activity was seen with lithium, SB415286, and AR-A014418 (Fig. 6C). The degree of GSK-3 inhibition directly correlated with the blockade of invasion, suggesting a direct link between GSK-3 activity and the rate of glioma invasion. Wound-healing assays also showed a dose-dependent reduction in U373 glioma cell migration in the presence of GSK-3 inhibitors (Fig. 6D). Finally, siRNA was used to specifically knock down GSK-3 isoforms. Both GSK-3
– and GSK-3β–specific siRNA treatment led to a 60% reduction in protein expression. This caused reduced cell motility in wound-healing assays for U373 cells and also in transwell assays using U87 and X12 glioma cells. This indicates that both GSK-3 isoforms play a role in glioma migration.
In conclusion, lithium potently and specifically reduces glioma cell invasion, and this effect may be mediated by the inhibition of both GSK-3
and GSK-3β in lithium-treated cells.
| Discussion |
|---|
|
|
|---|
Lithium has profound effects on a variety of processes, including metabolism, neuronal communication, and cell proliferation and development.8,9 These effects are cell type– and dose-dependent. For example, lithium stimulates cell proliferation in mammary tumor cells20 and inhibits proliferation in melanoma21 and hepatocellular carcinoma.22 Lithium is protective against cell death in neurons,23 but not against cellular stresses in glioma cells.24 Several protein activities are affected by lithium, with GSK-3 and IMPase having the strongest experimental support.10,11,25 Our data show that while IMPase is probably not important, GSK-3 may mediate the effects of lithium and may be an important driver of glioma cell motility. First, three distinct small molecule GSK-3 inhibitors (including lithium) caused a dose-dependent, reversible inhibition of glioma cell invasion in spheroid assays. Second, the degree of GSK-3 inhibition (measured by a luciferase reporter assay of β-catenin transcriptional activation) showed an inverse correlation with the degree of invasion, suggesting a direct link between GSK-3 activity and the rate of glioma invasion. This was supported by the observation that siRNA knockdown of either GSK-3
or GSK-3β slowed migration in a wound-healing assay, demonstrating that both GSK-3 isoforms play a role in glioma invasion. As with lithium, cell migration was prevented with each inhibitor, in all glioma cell types examined, and in multiple migration assays.
GSK-3 is a multifunctional serine-threonine protein kinase found in all eukaryotes that regulates diverse processes, including metabolism, cell fate specification, cell division, and cell death.26,27 Two closely related isoforms, GSK-3
and GSK-3β, function in multiple pathways, including Wnt, notch, tyrosine kinase, and G-protein coupled receptor signaling. Wnt signaling inactivates GSK-3, causing β-catenin stabilization and gene transcription. Independently of Wnt signaling, GSK-3 can be inactivated by phosphorylation at an N-terminal serine (serine-9 in GSK-3β). This is a highly dynamic process, with a number of converging pathways mediated by numerous kinases, including Akt, protein kinase A, and protein kinase C, and dephosphorylated by protein phosphatase 1.28 Interestingly, it does not appear that the effects of lithium on migration were confined to tumor cells, since normal human astrocyte migration was also inhibited. These results suggest that the effects of lithium may be independent of the status of the PTEN/Akt pathway that is disrupted in most gliomas and regulates GSK-3 activity.29
The role of GSK-3 in cancer cell migration is barely studied, and current data are conflicting. For example, it has been suggested that GSK-3 inhibition may promote cancer cell invasion and metastasis by promoting the epithelial to mesenchymal transition in some cancer types,30 and lithium was reported to promote the motility of colon cancer cells.31 On the other hand, pharmacological GSK-3 inhibition prevents epithelial cell migration,32 lamellipodia formation in keratinocytes,33 filopodia formation in neurons,34 and astrocyte cell movement.35 Several GSK-3 substrates are known to be involved in cell migration, including paxillin,36 FAK,37,38 NF-
B, β-catenin, and SNAIL (reviewed in ref. 39). The observation of breakdown of long lamellipodia in lithium-treated glioma cells suggests that GSK-3 activity is important in regulating the microtubules that support this structure, as has been proposed in keratinocytes.33 Several GSK-3 substrates play a role in microtubule regulation, including CRMPs40 and MAPs.41,42 The contribution of these various molecules to glioma migration is not yet known. Little is known regarding the function and status of GSK-3 in glioma cells. Akt phosphorylation and inhibition of GSK-3 may be involved in the stabilization of HIF-1
in U87 cells,43 and the inactivation of GSK-3 by Akt also supports glycolytic energy production in hypoxic or ischemic conditions due to the activation of glycogen synthase.44 Moreover, activation of glycolysis by GSK-3 inhibition was shown to support glioma cell migration in this study. However, GSK-3 is regulated by many other upstream signals in addition to Akt and can function independently in multiple pathways.26 Our data, suggesting that GSK-3 inhibition can block glioma cell migration, suggest that separate pools of GSK-3 may be regulated differentially during glioma invasion. Identification of proinvasive stimuli that activate GSK-3 is a major part of our ongoing studies in this area.
Lithium has a narrow therapeutic window and is often toxic at concentrations higher than 1.5 mM in vivo, mainly due to nephrotoxicity.7 Our data show that we could detect significant effects of lithium on glioma migration at concentrations as low as 5 mM and that at least one glioma cell (X14) was very sensitive to lithium at this dose. It is known that long-term lithium treatment in vivo does inhibit GSK-3, with a reported Ki of 1–2 mM,10 possibly by affecting additional pathways. Interestingly, it has been reported that cancer mortality and incidence are inversely proportional to lithium dose in patients taking lithium, particularly in cancers of nonepithelial origin.45 It is evident that detailed pharmacokinetic analysis in vivo will be required to determine if there is a dose of lithium that can significantly impact glioma cell migration. Alternative modes of administration (convection-enhanced delivery or local delivery with polymers) may be required to achieve significantly high doses of the drug in brain tumors in vivo, or alternatively, other GSK-3 inhibitors may need to be tested to find one that is applicable clinically.
On the basis of our data, we propose that lithium or other GSK-3 inhibitors may be an effective means of blocking glioma invasion as a therapeutic tool to prevent recurrence or further tumor spread. Because GSK-3 is a widely recognized therapeutic target in other diseases, such as diabetes and Alzheimer's disease, a variety of GSK-3 inhibitors have been developed, providing a rich source of candidate molecules to study as potential anti-invasive candidates.
| Acknowledgments |
|---|
Received for publication October 3, 2007. Accepted for publication March 17, 2008.
| References |
|---|
|
|
|---|
Demuth T, Berens ME. Molecular mechanisms of glioma cell migration and invasion. J Neurooncol. 2004;70: 217-218.[CrossRef][Medline]
Giese A, Bjerkvig R, Berens ME, Westphal M. Cost of migration: invasion of malignant gliomas and implications for treatment. J Clin Oncol. 2003;21: 1624-1636.
Levin VA, Phuphanich S, Alfred Yung WK, et al. Randomized, double-blind, placebo-controlled trial of marimastat in glioblastoma multiforme patients following surgery and irradiation. J Neurooncol. 2006;78: 295-302.[CrossRef][Medline]
Bellail AC, Hunter SB, Brat DJ, Tan C, Van Meir EG. Microregional extracellular matrix heterogeneity in brain modulates glioma cell invasion. Int J Biochem Cell Biol. 2004;36: 1046-1069.[CrossRef][ISI][Medline]
Angers-Loustau A, Hering R, Werbowetski TE, Kaplan DR, Del Maestro RF. SRC regulates actin dynamics and invasion of malignant glial cells in three dimensions. Mol Cancer Res. 2004;2: 595-605.
Perego C, Vanoni C, Massari S, et al. Invasive behaviour of glioblastoma cell lines is associated with altered organisation of the cadherin-catenin adhesion system. J Cell Sci. 2002;115: 3331-3340.
Markovic DS, Glass R, Synowitz M, Rooijen N, Kettenmann H. Microglia stimulate the invasiveness of glioma cells by increasing the activity of metalloprotease-2. J Neuropathol Exp Neurol. 2005;64: 754-762.[ISI][Medline]
Phiel CJ, Klein PS. Molecular targets of lithium action. Ann Rev Pharmacol Toxicol. 2001;41: 789-813.[CrossRef][ISI][Medline]
Williams R, Ryves WJ, Dalton EC, et al. A molecular cell biology of lithium. Biochem Soc Trans. 2004;32: 799-802.[CrossRef][ISI][Medline]
Klein PS, Melton DA. A molecular mechanism for the effect of lithium on development. Proc Natl Acad Sci USA. 1996;93: 8455-8459.
Stambolic V, Ruel L, Woodgett JR. Lithium inhibits glycogen synthase kinase-3 activity and mimics wingless signalling in intact cells. Curr Biol. 1996;6: 1664-1668.[CrossRef][ISI][Medline]
Giannini C, Sarkaria JN, Saito A, et al. Patient tumor EGFR and PDG-FRA gene amplifications retained in an invasive intracranial xenograft model of glioblastoma multiforme. Neuro-oncol. 2005;7: 164-176.[Abstract]
Del Duca D, Werbowetski T, Del Maestro RF. Spheroid preparation from hanging drops: characterization of a model of brain tumor invasion. J Neurooncol. 2004;67: 295-303.[CrossRef][Medline]
Stein AM, Demuth T, Mobley D, Berens ME, Sander LM. Describing glioblastoma invasion in a 3d in vitro experiment using a mathematical model of motility, shedding, and proliferation. Biophys J. 2007;92: 356-365.
Veeman MT, Axelrod JD, Moon RT. A second canon. Functions and mechanisms of beta-catenin-independent Wnt signaling. Dev Cell. 2003;5: 367-377.[CrossRef][ISI][Medline]
Harwood AJ. Lithium and bipolar mood disorder: the inositol-depletion hypothesis revisited. Mol Psychiatry. 2005;10: 117-126.[CrossRef][ISI][Medline]
Atack JR, Cook SM, Watt AP, et al. In vitro and in vivo inhibition of inositol monophosphatase by the bisphosphonate L-690,330. J Neurochem. 1993;60: 652-658.[CrossRef][ISI][Medline]
Coghlan MP, Culbert AA, Cross DA, et al. Selective small molecule inhibitors of glycogen synthase kinase-3 modulate glycogen metabolism and gene transcription. Chem Biol. 2000;7: 793-803.[CrossRef][ISI][Medline]
Gould TD, Einat H, Bhat R, Manji HK. AR-A014418, a selective GSK-3 inhibitor, produces antidepressant-like effects in the forced swim test. Int J Neuropsychopharmacol. 2004;7: 387-390.[CrossRef][ISI][Medline]
Ptashne K, Stockdale FE, Conlon S. Initiation of DNA synthesis in mammary epithelium and mammary tumors by lithium ions. J Cell Physiol. 1980;103: 41-46.[CrossRef][ISI][Medline]
Nordenberg J, Panet C, Wasserman L, et al. The anti-proliferative effect of lithium on melanoma cells and its reversion by myo-inositol. Br J Cancer. 1987;55: 41-46.[ISI][Medline]
Erdal E, Ozturk N, Cagatay T, Eksioglu-Demiralp E, Ozturk M. Lithium-mediated downregulation of PKB.Akt and cyclin E with growth inhibition in hepatocellular carcinoma cells. Int J Cancer. 2005;115: 903-910.[CrossRef][ISI][Medline]
Alvarez G, Munoz-Montano JR, Satrustegui J, Avila J, Bogonez E, Diaz-Nido J. Lithium protects cultured neurons against β-amyloid-induced neurodegeneration. FEBS Lett. 1999;453: 260-264.[CrossRef][ISI][Medline]
Lai JS, Zhao C, Warch JJ, Li PP. Cytoprotection by lithium and valproate varies between cell types and cellular stresses. Eur J Pharmacol. 2006;539: 18-26.[CrossRef][ISI][Medline]
Gould TD, Manji HK. Glycogen synthase kinase-3: a putative molecular target for lithium mimetic drugs. Neuropsychopharmacol. 2005;20: 1223-1237.
Doble BW, Woodgett JR. GSK-3: tricks of the trade for a multi-tasking kinase. J Cell Sci. 2003;116: 1175-1186.
Frame S, Cohen P. GSK3 takes center stage more than 20 years after its discovery. Biochem J. 2001;359: 1-16.[CrossRef][ISI][Medline]
Cross DA, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature. 1995;378: 785-789.[CrossRef][ISI][Medline]
Zhang F, Phiel CJ, Spece L, Gurvich N, Klein PS. Inhibitory phosphorylation of glycogen synthase kinase-3 (GSK-3) in response to lithium. Evidence for autoregulation of GSK-3. J Biol Chem. 2003;278: 33067-33077.
Doble BW, Woodgett JR. Role of glycogen synthase kinase-3 in cell fate and epithelial-mesenchymal transitions. Cells Tissues Organs. 2007;185: 73-84.[CrossRef][Medline]
Le Floch N, Rivat C, De Wever O, et al. The proinvasive activity of Wnt-2 is mediated through a noncanonical Wnt pathway coupled to GSK-3β and c-Jun/AP-1 signaling. Faseb J. 2005;19: 144-146.
Farooqui AA, Ong WY, Horrocks LA. Glycogen synthase kinase-3 acts upstream of ADP-ribosylation factor 6 and Rac1 to regulate epithelial cell migration. Pharmacol Rev. 2006;58: 591-620.
Koivisto L, Hakkinen L, Matsumoto K, McCulloch CA, Yamada KM, Larjava H Exp Cell Res. 2004;293: 68-80.[CrossRef][ISI][Medline]
Owen R, Gordon-Weeks PR. Inhibition of glycogen synthase kinase 3β in sensory neurons in culture alters filopodia dynamics and microtubule distribution in growth cones. Mol Cell Neurosci. 2003;23: 626-637.[CrossRef][ISI][Medline]
Etienne-Manneville S, Hall A. Cdc42 regulates GSK-3beta and adenomatous polyposis coli to control cell polarity. Nature. 2003;421: 753-756.[CrossRef][ISI][Medline]
Cai X, Li M, Vrana J, Schaller MD. Glycogen synthase kinase 3-β and extracellular signal–regulated kinase-dependent phosphorylation of paxillin regulates cytoskeletal rearrangement. Mol Cell Biol. 2006;26: 2857-2868.
Bianchi M, De Lucchini S, Marin O, Turner DL, Hanks SK, Villa-Moruzzi E. Regulation of FAK Ser-722 phosphorylation and kinase activity by GSK3 and PP1 during cell spreading and migration. Biochem J. 2005;391: 359-370.[CrossRef][ISI][Medline]
Kobayashi T, Hino S, Oue N, et al. Glycogen synthase kinase 3 and h-prune regulate cell migration by modulating focal adhesions. Mol Cell Biol. 2006;26: 898-911.
Jope RS, Yuskaitis CJ, Beurel E. Glycogen synthase kinase-3 (GSK3): inflammation, diseases, and therapeutics. Neurochem Res. 2006;32: 577-595.[CrossRef][ISI][Medline]
Yoshimura T, Kawano Y, Arimura N, Kawabata S, Kikuchi A, Kaibuchi K. GSK-3β regulates phosphorylation of CRMP-2 and neuronal polarity. Cell. 2005;120: 137-149.[CrossRef][ISI][Medline]
Goold RG, Owen R, Gordon-Weeks PR. Glycogen synthase kinase 3β phosphorylation of microtubule-associated protein 1B regulates the stability of microtubules in growth cones. J Cell Sci. 1999;112: 3373-3384.[Abstract]
Sanchez C, Perez M, Avila J. GSK3β-mediated phosphorylation of the microtubule-associated protein 2C (MAP2C) prevents microtubule bundling. Eur J Cell Biol. 2000;79: 252-260.[CrossRef][ISI][Medline]
Skuli N, Monferran S, Delmas C, Lajoie-Mazenc I, Favre G, Toulas C, Cohen-Jonathan-Moyal, E. Activation of RhoB by hypoxia controls hypoxia-inducible factor-1 alpha stabilization through glycogen synthase kinase-3 in U87 glioblastoma cells. Cancer Res. 2006;66: 482-489.
Beckner ME, Gobbel GT, Abounader R, Burovic F, Agostino NR, Laterra J, Pollack IF. Glycolytic glioma cells with active glycogen synthase are sensitive to PTEN and inhibitors of PI3K and gluconeogenesis. Lab Invest. 2005;85: 1457-1470.[ISI][Medline]
Cohen Y, Chetrit A, Cohen Y, Sirota P, Modan B. Cancer morbidity in psychiatric patients: influence of lithium carbonate treatment. Medical Oncology. 1998;15: 32-36.[ISI][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|